Illumina Sequencing Guide

Lab reference for library structures, amplicon primer design, and custom index management

Illumina sequencing is fundamentally sequencing by synthesis (SBS). Every library prep kit — regardless of brand, application, or sample type — accomplishes one thing: adding defined adaptor sequences to both ends of your DNA inserts. Understanding these adaptors is essential for designing custom amplicon primers and multiplexing strategies.

Core Principle

All Illumina libraries must contain the P5 and P7 flow cell binding sequences at their ends. Everything in between (sequencing primers, indexes, insert) can vary by kit and application.

Adaptor Anatomy

Two essential sequences anchor every Illumina library to the flow cell:

P5 adaptor: 5'- AATGATACGGCGACCACCGAGATCTACAC -3'

P7 adaptor: 5'- CAAGCAGAAGACGGCATACGAGAT -3'

Between P5 and P7, libraries contain sequencing primer binding sites (e.g. Truseq R1, R2), optional index sequences (i5, i7) for multiplexing, and the DNA insert itself.

P5 (flow cell)
P7 (flow cell)
Read 1 primer
Read 2 primer
Index (i5/i7)
Insert DNA

Sequencing Read Order

Illumina instruments sequence reads in a defined order, which determines how indexes are read and how sample sheets must be configured.

1
Read 1 R1
Read 1 sequencing primer anneals and extends through the insert (bottom strand as template). For Truseq libraries: primes from ACACTCTTTCCCTACACGACGCTCTTCCGATCT.
2
Index 1 (i7) i7
The i7 index is read first. Located adjacent to P7. Always read as written in the adapter sequence (forward orientation for sample sheet on most instruments).
3
Index 2 (i5) i5
Instrument-dependent: MiSeq, NovaSeq v1.0, HiSeq 2000/2500 read i5 as reverse complement. iSeq, MiniSeq, NextSeq, HiSeq X/3000/4000, NovaSeq v1.5 read i5 forward (in-solution primer). Check instrument before populating sample sheet.
4
Read 2 R2
After cluster regeneration, Read 2 primer extends in the reverse direction through the insert (top strand as template). For Truseq: primes from TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG.
⚠ i5 Reverse Complement Warning

iSeq, MiniSeq, NextSeq 500/550, HiSeq 3000/4000/X, and NovaSeq 6000 v1.5 require the reverse complement of i5 in the sample sheet. If using Illumina software (IEM, BaseSpace, Local Run Manager), this is done automatically. Manual sample sheets require careful attention to which column to use from the adapter tables.

Library Structures

Detailed diagrams of Truseq and Nextera library architectures

Truseq Single Index
Truseq Dual Index
Nextera Dual Index

Truseq Single Index Library

Uses only an i7 index. The i5 side has no sample-specific barcode. Suitable for lower-plex experiments on instruments that don't require dual indexing.

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
◂ Illumina P5 ▸ ◂ TruSeq Read 1 ▸ ◂ Insert ▸ ◂ TruSeq Read 2 ▸ ◂ i7 ▸ ◂ Illumina P7 ▸

Read 1 Sequencing

                     5'- ACACTCTTTCCCTACACGACGCTCTTCCGATCT---->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Index 1 (i7) Sequencing

                                                                   5'- GATCGGAAGAGCACACGTCTGAACTCCAGTCAC------->
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'

Read 2 Sequencing

5'- AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
                                                               <------TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG -5'

Truseq Dual Index Library

Uses both i5 and i7 indexes, enabling higher-plex multiplexing. The i5 index is embedded on the P5 side. This is the recommended format for most modern experiments.

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNACACTCTTTCCCTACACGACGCTCTTCCGATCT-insert-AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNTGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-insert-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
◂ P5 ▸ ◂ i5 ▸ ◂ TruSeq Read 1 ▸ ◂ Insert ▸ ◂ TruSeq Read 2 ▸ ◂ i7 ▸ ◂ P7 ▸
Key Sequences

Truseq R1 primer site: TCCCTACACGACGCTCTTCCGATCT (as provided to sequencing service)
Truseq R2 primer site: GTTCAGACGTGTGCTCTTCCGATCT (as provided to sequencing service)

Nextera Dual Index Library

Uses Nextera-specific Read 1 and Read 2 sequencing primer binding sites. The transposase adapter CTGTCTCTTATACACATCT is the key trimming sequence.

5'- AATGATACGGCGACCACCGAGATCTACACNNNNNNNNTCGTCGGCAGCGTCAGATGTGTATAAGAGACAG-insert-CTGTCTCTTATACACATCTCCGAGCCCACGAGACNNNNNNNNATCTCGTATGCCGTCTTCTGCTTG -3'
3'- TTACTATGCCGCTGGTGGCTCTAGATGTGNNNNNNNNAGCAGCCGTCGCAGTCTACACATATTCTCTGTC-insert-GACAGAGAATATGTGTAGAGGCTCGGGTGCTCTGNNNNNNNNTAGAGCATACGGCAGAAGACGAAC -5'
◂ P5 ▸ ◂ i5 ▸ ◂ Nextera Read 1 ▸ ◂ Insert ▸ ◂ Nextera Read 2 ▸ ◂ i7 ▸ ◂ P7 ▸

Nextera adapter trimming sequence: CTGTCTCTTATACACATCT

Amplicon Primer Design

Guide for designing amplicon sequencing primers compatible with TruSeq R1/R2 services

Primer Architecture

Sequencing services that use TruSeq Read 1 and Read 2 primer pairs expect amplicons structured as follows. Your PCR primers must add the Truseq adapter sequences, an optional inline index, and your gene-specific sequence.

Service-Provided Truseq Sequences

R1 (Read 1 primer site): TCCCTACACGACGCTCTTCCGATCT
R2 (Read 2 primer site): GTTCAGACGTGTGCTCTTCCGATCT

Forward Primer (R1-based)

TCCCTACACGACGCTCTTCCGATCT-NNNNNN-<gene-specific forward sequence>
◂ TruSeq R1 primer site ▸ ◂ inline index ▸ ◂ GSP: binds target, + strand ▸

Reverse Primer (R2-based)

GTTCAGACGTGTGCTCTTCCGATCT-NNNNNN-<reverse complement of gene-specific reverse sequence>
◂ TruSeq R2 primer site ▸ ◂ inline index ▸ ◂ GSP: binds target, - strand RC ▸

Resulting Amplicon Structure

When these primers are used in PCR, the amplicon will have the following structure, which is directly sequenceable after the TruSeq R1/R2 sequencing primers anneal:

5'—TCCCTACACGACGCTCTTCCGATCT—idx_fwd—[fwd GSP → insert ← rev GSP]—idx_rev_rc—AGATCGGAAGAGCACGTCTGAAC—3'
◂ R1 site ▸ ◂ idx ▸ ◂ insert ▸ ◂ idx ▸ ◂ R2 site ▸
→ R1 reads left to right from R1 site through index + insert
← R2 reads right to left from R2 site through insert + index

Multiplexing Strategy

To pool multiple samples using a single sequencing lane, assign unique inline indexes (NNNNNN) to each sample's forward and/or reverse primers. These inline indexes are read as part of the sequencing read and demultiplexed computationally.

Recommended Strategy

Use a unique 6–8bp inline index on the forward primer only. This simplifies demultiplexing since R1 always contains the index at a fixed position (immediately after the R1 primer site). Ensure indexes differ by ≥ 3 bp (Hamming distance) for error-tolerant demultiplexing.

⚠ Index Design Rules

• No homopolymer runs > 2 bp (e.g. avoid AAAGCT)
• Balanced GC content (40–60%)
• No sequences identical or highly similar to existing Illumina indexes (check the Custom Index tab)
• Minimum Hamming distance of 3 between all indexes in a pool
• Avoid sequences matching common adapters or PhiX control

Primer Designer Tool

Build Your Primers

Design Considerations

Gene-Specific Primer Design

The gene-specific portion of your primer should follow standard PCR primer design rules, but with important caveats for amplicon sequencing:

  • Aim for Tm of 58–65°C for the gene-specific portion alone (not including the adapter)
  • Keep gene-specific portion to 18–25 bp
  • Avoid 3' end GC clamps longer than 3 consecutive G/C
  • Check for secondary structures and primer dimers with the adapter included
  • Amplicon size: aim for 200–500 bp for optimal cluster generation (accounts for adapter overhead)

Sequencing Depth

With inline indexing, plan for approximately 10,000–50,000 reads per sample per amplicon for quantitative applications. Deeper coverage improves variant detection sensitivity.

Illumina Adapter Database

Reference sequences from Document #1000000002694 v14 (July 2020)

Source

All sequences below are from the Illumina Adapter Sequences document v14. Oligonucleotide sequences © 2020 Illumina, Inc. All rights reserved.

Name Kit / Category Type Sequence (5'→3') Notes

Lab Custom Index Registry

Shared index registry synced to GitHub — all lab members see the same data

GitHub Sync

Indexes are stored in lab_indexes.json in the ODonnellLab / lab-sequencing-tools private GitHub repo. Every add/delete creates a timestamped commit — full history is viewable at github.com/mikeod38/lab-sequencing-tools.

Conflict Checker

Check a Sequence

Lab Index Registry 0 indexes

Index Name Sequence (5'→3') Length GC% Status Notes Added by · Date

Add New Index

Adding as: